View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11543_low_38 (Length: 239)

Name: NF11543_low_38
Description: NF11543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11543_low_38
NF11543_low_38
[»] chr5 (2 HSPs)
chr5 (88-224)||(43232045-43232181)
chr5 (43-92)||(43231969-43232018)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 88 - 224
Target Start/End: Original strand, 43232045 - 43232181
Alignment:
Q  88 atataagacctctacttgatatttgttacacacagaaagctaaattgggattctcttggaagatgatttagaattcaaaatttcaaatctattgtgtgtg 187  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||    
T  43232045 atatgagacctctacttgatatttgttacacacagaaagctaaattgggattctcttggaagatgatgcagaattcaaaatttcaaatctattgtgtgtg 43232144  T
Q  188 tgtaaatgccttcatgatcccttattacatacttatt 224  Q
    |||||||||||||||||||||||||||||||||||||    
T  43232145 tgtaaatgccttcatgatcccttattacatacttatt 43232181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 43231969 - 43232018
Alignment:
Q  43 ccaaaaccataatatcatattatgtttacgggtcatcttacttgtatata 92  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||    
T  43231969 ccaaaaccataatatcatattatgtttatgggtcatcttacttgtatata 43232018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University