View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11540_high_2 (Length: 353)

Name: NF11540_high_2
Description: NF11540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11540_high_2
NF11540_high_2
[»] chr4 (1 HSPs)
chr4 (13-326)||(49861459-49861754)


Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 13 - 326
Target Start/End: Complemental strand, 49861754 - 49861459
Alignment:
Q  13 tgaagcaggggcggacgggtccacgtaaaagatgaaaggttgacgacggagatggcggttacggcggaggtgttgacgtgtgcgatcacgtagaaggtag 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||                  |||||||||||||||||||||||||||||||    
T  49861754 tgaagcaggggcggacgggtccacgtaaaagatgaaaggttgacgacggag------------------gtgttgacgtgtgcgatcacgtagaaggtag 49861673  T
Q  113 tatcgaattagaaaatggagacagagcattattatgataacggcgaagagaatgataatggcggttagcattatcttgccgctgagggcataattgtttt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49861672 tatcgaattagaaaatggagacagagcattattatgataacggcgaagagaatgataatggcggttagcattatcttgccgctgagggcataattgtttt 49861573  T
Q  213 cgatttctctttcattatccatgttcgaattcatctgagtagaataaatgaatggcacagtaaaatgttgttggaattgagaatgggaaggttacttcga 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49861572 cgatttctctttcattatccatgttcgaattcatctgagtagaataaatgaatggcacagtaaaatgttgttggaattgagaatgggaaggttacttcga 49861473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University