View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1153_high_44 (Length: 272)

Name: NF1153_high_44
Description: NF1153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1153_high_44
NF1153_high_44
[»] chr2 (1 HSPs)
chr2 (51-243)||(3131709-3131901)


Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 51 - 243
Target Start/End: Original strand, 3131709 - 3131901
Alignment:
Q  51 gtagagagtgccagtggcaataccgaggagcacgatgaggaggaaggttaatgccataaaccaacaaaagcaacggcatcgccggttagggcgttgtctt 150  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3131709 gtagagagtgccagtagcaataccgaggagcacgatgaggaggaaggttaatgccataaaccaacaaaagcaacggcatcgccggttagggcgttgtctt 3131808  T
Q  151 aggcgagtgtattcttggtagcggcgagctttctccgatggagagacactgaaggtttgattcttgggagctttgatgactagggctctctgc 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3131809 aggcgagtgtattcttggtagcggcgagctttctccgatggagagacactgaaggtttgattcttgggagctttgatgactagggctctctgc 3131901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University