View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11520_high_14 (Length: 237)

Name: NF11520_high_14
Description: NF11520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11520_high_14
NF11520_high_14
[»] chr8 (1 HSPs)
chr8 (16-225)||(3065404-3065613)


Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 225
Target Start/End: Complemental strand, 3065613 - 3065404
Alignment:
Q  16 ttatttttgcggagatcatgcaagttgttccaattcatccacgaccaaagtaaataggtggaaactgaaggaaattcagatggagtagtacaacaagttc 115  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  3065613 ttatttttgcggagatcatgcaagttgttccaattcatccacaaccaaagtaaatgggtggaaactgaaggaaattcagatggagtagtacaacaagttc 3065514  T
Q  116 tacttgaaataagaaaaatgaacatgacagaagaagaggtgaggatggttttaggacgaaaatggccggaggcagctggagtggctccaagacgacaggg 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3065513 tacttgaaataagaaaaatgaacatgacagaagaagaggtgaggatggttttaggacgaaaatggccggaggcagctggagtggctccaagacgacaggg 3065414  T
Q  216 tgagtctctg 225  Q
    ||||||||||    
T  3065413 tgagtctctg 3065404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University