View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1150_low_85 (Length: 205)

Name: NF1150_low_85
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1150_low_85
NF1150_low_85
[»] chr8 (1 HSPs)
chr8 (23-194)||(6026174-6026345)
[»] chr2 (2 HSPs)
chr2 (37-110)||(42824262-42824335)
chr2 (121-194)||(42824166-42824239)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 23 - 194
Target Start/End: Complemental strand, 6026345 - 6026174
Alignment:
Q  23 aatacaatattcaaggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataagccccaaatggcttgttatgct 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
T  6026345 aatacaatattcaaggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataatccccaaatggcttgttctgct 6026246  T
Q  123 tggtacttgagtagcttcacatggaaaacaaccataacatttatgctcacagcttggtggacttgaccctat 194  Q
    ||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||    
T  6026245 tggcacttgagtagcttcacatggaaaacaatcatagcatttatgctcacagcttggtggacttgaccctat 6026174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 37 - 110
Target Start/End: Complemental strand, 42824335 - 42824262
Alignment:
Q  37 ggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataagccccaaatg 110  Q
    ||||| ||||| ||||||||||| ||||||||||| || |||||||||||||||||||||  ||| ||||||||    
T  42824335 ggactgtagaaggaaggaccacatttgcatttccagctttcaggctcataatttgcatactgaagacccaaatg 42824262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 194
Target Start/End: Complemental strand, 42824239 - 42824166
Alignment:
Q  121 cttggtacttgagtagcttcacatggaaaacaaccataacatttatgctcacagcttggtggacttgaccctat 194  Q
    ||||| |||||| | ||||||||||||   || |||||||| || |||||||||||||||||||||||||||||    
T  42824239 cttggaacttgaatggcttcacatggattgcatccataacacttgtgctcacagcttggtggacttgaccctat 42824166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University