View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1150_low_84 (Length: 206)

Name: NF1150_low_84
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1150_low_84
NF1150_low_84
[»] chr8 (1 HSPs)
chr8 (24-195)||(6026174-6026345)
[»] chr2 (2 HSPs)
chr2 (38-97)||(42824276-42824335)
chr2 (122-195)||(42824166-42824239)


Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 24 - 195
Target Start/End: Complemental strand, 6026345 - 6026174
Alignment:
Q  24 aatacaatattcaaggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataatccccaaatggcttgttctgct 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6026345 aatacaatattcaaggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataatccccaaatggcttgttctgct 6026246  T
Q  124 tggtacttgagtagcttcacatggaaaacaaccataacatttatgctcacagcttggtggacttgaccctat 195  Q
    ||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||    
T  6026245 tggcacttgagtagcttcacatggaaaacaatcatagcatttatgctcacagcttggtggacttgaccctat 6026174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 42824335 - 42824276
Alignment:
Q  38 ggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatac 97  Q
    ||||| ||||| ||||||||||| ||||||||||| || |||||||||||||||||||||    
T  42824335 ggactgtagaaggaaggaccacatttgcatttccagctttcaggctcataatttgcatac 42824276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 195
Target Start/End: Complemental strand, 42824239 - 42824166
Alignment:
Q  122 cttggtacttgagtagcttcacatggaaaacaaccataacatttatgctcacagcttggtggacttgaccctat 195  Q
    ||||| |||||| | ||||||||||||   || |||||||| || |||||||||||||||||||||||||||||    
T  42824239 cttggaacttgaatggcttcacatggattgcatccataacacttgtgctcacagcttggtggacttgaccctat 42824166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University