View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11509_high_27 (Length: 252)

Name: NF11509_high_27
Description: NF11509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11509_high_27
NF11509_high_27
[»] chr2 (1 HSPs)
chr2 (146-237)||(7908579-7908670)


Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 146 - 237
Target Start/End: Original strand, 7908579 - 7908670
Alignment:
Q  146 ctcatttgaaatttttattttataagtaacatgtcaatgtttgnnnnnnnngtagtttgcgaagtcatgtgcaggtgtggtagagtttctac 237  Q
    ||||||||||||||||||||||||||||||||||||||||| |        |||||||||||||||||||||||||||||||||||||||||    
T  7908579 ctcatttgaaatttttattttataagtaacatgtcaatgttcgaaaaaaaagtagtttgcgaagtcatgtgcaggtgtggtagagtttctac 7908670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University