View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11490_low_15 (Length: 290)

Name: NF11490_low_15
Description: NF11490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11490_low_15
NF11490_low_15
[»] chr7 (1 HSPs)
chr7 (20-278)||(26901379-26901637)


Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 278
Target Start/End: Complemental strand, 26901637 - 26901379
Alignment:
Q  20 accctgatgtggttgcagcgatcattgatcaaacgaaaaaattacagcactcaacggtgttgtatctgaatcatgctgttgctgattttgcggaagcttt 119  Q
    |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26901637 accctgatgtggtttcagcgatcgttgatcaaacgaaaaaattacagcactcaacggtgttgtatctgaatcatgctgttgctgattttgcggaagcttt 26901538  T
Q  120 ggctggtaaactccccggtgatcttaaggtaaactttgtttaacgttaccgtaatctcaattttgttactgtttagtttgatttaatagtaannnnnnna 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |    
T  26901537 ggctggtaaactccccggtgatcttaaggtaaactttgtttaacgttaccgtaatctcaattttgttactgtttagtttgatttaatagtaattttttta 26901438  T
Q  220 cggaatttgattctatatagtataaatctttttcttataatcacatgctcaatggtttc 278  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||    
T  26901437 cggaatttgattttatgtagtataaatctttttcttataatcacatgctcaatggtttc 26901379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University