View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11475_low_40 (Length: 240)

Name: NF11475_low_40
Description: NF11475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11475_low_40
NF11475_low_40
[»] chr1 (2 HSPs)
chr1 (132-210)||(28573272-28573350)
chr1 (17-60)||(28573343-28573386)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 132 - 210
Target Start/End: Complemental strand, 28573350 - 28573272
Alignment:
Q  132 gaataatttaagaagatgatgaattccttttgatggggcttagtgggaaacaatcaaaagacatccgttggttctcttg 210  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  28573350 gaataatttaagaagatgatgaattccttttgatggggcttattgggaaacaatcaaaagacatccgttggttctcttg 28573272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 28573386 - 28573343
Alignment:
Q  17 atatcttaagtagtaagtgtctatctcaagcaagcagagtaatt 60  Q
    |||||||||||||||||||||||||||||||||||||| |||||    
T  28573386 atatcttaagtagtaagtgtctatctcaagcaagcagaataatt 28573343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University