View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11471_low_31 (Length: 228)

Name: NF11471_low_31
Description: NF11471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11471_low_31
NF11471_low_31
[»] chr5 (1 HSPs)
chr5 (6-228)||(43013407-43013641)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 43013407 - 43013641
Alignment:
Q  6 attataaagtataaaggttttgggaaagtaaacnnnnnnn-gttgttgtttaaggaattgggaaagtaacctagattctttaatggtaaagtatcgtcaa 104  Q
    |||| ||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43013407 attaaaaagtataaaggttttgggaaagtaaacttttttttgttgttgtttaaggaattgggaaagtaacctagattctttaatggtaaagtatcgtcaa 43013506  T
Q  105 tcaaaactacaaaaattatcaaataatctttataaaacatattccctggtt-----------ataacatagttggatattttgttgaagaaataaaagat 193  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||| |||           | ||||||||||||||||||||||||||||||||||||    
T  43013507 tcaaaactacaaaaattatcaaataatctttataaaacataatccctcgttcaaaaaaaaaaaaaacatagttggatattttgttgaagaaataaaagat 43013606  T
Q  194 agaatcgttataaagttataaacaacaaaaaatat 228  Q
    |||||||||||||||||||||||||||||||||||    
T  43013607 agaatcgttataaagttataaacaacaaaaaatat 43013641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University