View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11471_high_10 (Length: 299)

Name: NF11471_high_10
Description: NF11471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11471_high_10
NF11471_high_10
[»] scaffold1333 (1 HSPs)
scaffold1333 (9-280)||(1474-1745)


Alignment Details
Target: scaffold1333 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: scaffold1333
Description:

Target: scaffold1333; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 280
Target Start/End: Original strand, 1474 - 1745
Alignment:
Q  9 agcagagaagcttaaggaaaaagagaaagaatgtgagccaaaattgtatgcttgcagcttagaacagaaagaaaaaacttgctttagaggatgttaattt 108  Q
    |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1474 agcagagaagcttaaggaaaaagagagagaatgtgagccaaaattctatgcttgcagcttagaacagaaagaaaaaacttgctttagaggatgttaattt 1573  T
Q  109 gaggagtgagttaaacatttagtaatacttgagagaagtctatattagagaagtggaggaaatgaaattcaatgaagaaaattggcaaaagaagaatcaa 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  1574 gaggagtgagttaaacatttagtaatacttgagagaagtctatattagagaagtggaggaaatgaaattcaaagaagaaaattggcaaaagaagaatcaa 1673  T
Q  209 gacttggggaatcaaaaagtttctcagagaaaaatcaaaccatcaaaccatacaaagagtttagctgaatct 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1674 gacttggggaatcaaaaagtttctcagagaaaaatcaaaccatcaaaccatacaaagagtttagctgaatct 1745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University