View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11462_high_12 (Length: 288)

Name: NF11462_high_12
Description: NF11462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11462_high_12
NF11462_high_12
[»] chr8 (1 HSPs)
chr8 (1-196)||(43543429-43543630)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 43543630 - 43543429
Alignment:
Q  1 gggtagtgctaaaagacatacagtggcagataactgaagacgctttttagaagatg------cagctgccgaatgagtgatgtactgagcagtgacatct 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||| ||||||||||||||||||||||||||||||    
T  43543630 gggtagtgctaaaagacatacagtggcagataactgaagacgctttttagaagatgaagatgcagctgctgaatgagtgatgtactgagcagtgacatct 43543531  T
Q  95 ccaacggcccaaaggacgccggaggtggcgacttgggttctcaccggatgaacggagaggctattctgataccaattccatgccctcaatatcatcgaca 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43543530 ccaacggcccaaaggacgccggaggtggcgacttgggttctcaccggatgaacggagaggctattctgataccaattccatgccctcaatatcatcgaca 43543431  T
Q  195 tg 196  Q
    ||    
T  43543430 tg 43543429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University