View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1145_low_174 (Length: 229)

Name: NF1145_low_174
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1145_low_174
NF1145_low_174
[»] chr1 (1 HSPs)
chr1 (24-130)||(50463990-50464096)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 24 - 130
Target Start/End: Complemental strand, 50464096 - 50463990
Alignment:
Q  24 gttgatgcgtgcattgaataacattgaattttactaacctacaaattaaattcacacatgaaagcacctaccagaccccatttccttgtcatattctttt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50464096 gttgatgcgtgcattgaataacattgaattttactaacctacaaattaaattcacacatgaaagcacctaccagaccccatttccttgtcatattctttt 50463997  T
Q  124 gcttcat 130  Q
    |||||||    
T  50463996 gcttcat 50463990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University