View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1145_low_144 (Length: 263)

Name: NF1145_low_144
Description: NF1145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1145_low_144
NF1145_low_144
[»] chr5 (1 HSPs)
chr5 (1-255)||(43200219-43200473)


Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 43200473 - 43200219
Alignment:
Q  1 catatctctaaaagctcacaactaaattacctgctagatataacatcaaaagtttacattgattgtgtatttttcattgataaagcatctttacatcagt 100  Q
    ||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  43200473 catatctataaaagctcacaactaagttacctgctagatataccatcaaaagtttacattgattgtgtatttttcattaataaagcatctttacatcagt 43200374  T
Q  101 taattagaatgtaactatccatgttactactttgttggcgattcttcatcatcattggtgtcttcatacgattcttctggttgagtaggaacaaatgtta 200  Q
    |||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  43200373 taattagaatgtaactattcatattactactttgttggcgattcttcatcatcattggtgtcttcatacgattcttctggttgaggaggaacaaatgtta 43200274  T
Q  201 atttgagcacttctaccaaccatggggacataggaccatcagtgcgtttcttttc 255  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43200273 atttgagcacttctaccaaccatggggacataggaccatcagtgcgtttcttttc 43200219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University