View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11457_high_19 (Length: 244)

Name: NF11457_high_19
Description: NF11457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11457_high_19
NF11457_high_19
[»] chr8 (1 HSPs)
chr8 (97-229)||(39862431-39862566)


Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 97 - 229
Target Start/End: Original strand, 39862431 - 39862566
Alignment:
Q  97 tgattttgtcctcaaactcaaatttcagctgtcacactttattttcacgcnnnnnnnnn---tgaaactttatagagtgaaagaggaaactaccgatctt 193  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||||||||    
T  39862431 tgattttgtcctaaaactcaaatttcagctgtcacactttattttcacgcaaaaaaaaaaaatgaaactttatagagtgaaagaggaaactaccgatctt 39862530  T
Q  194 gttttccagaaacaacactaaaattattcatttatg 229  Q
    ||||||||||||||||||||||||||||||||||||    
T  39862531 gttttccagaaacaacactaaaattattcatttatg 39862566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University