View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_614 (Length: 224)

Name: NF11453A_low_614
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_614
NF11453A_low_614
[»] chr1 (1 HSPs)
chr1 (12-224)||(36173004-36173216)


Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 36173216 - 36173004
Alignment:
Q  12 acatcagacacccactaaacgtagttatcttttttggcgtaacattcagtttgataacaataaagtgtacttcagtaattgcagtaataaaacaatagaa 111  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  36173216 acatcagacacccactaaacgtagttatcttttttggcgcaacattcagtttgataacaataaagtgtacttcagtaattccagtaataaaacaatagaa 36173117  T
Q  112 tgtgcttctgtnnnnnnnnnnnnnnnnnnnncggagtgcactattgttcactcaggctctagaactagggaggctgaatgtaataatcaggacggtttct 211  Q
    |||||||||||                     ||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||| |||||||||||    
T  36173116 tgtgcttctgtaaaaaaaaaaaaaaaaaaaatggagtgcactatttttcactcaggctctagaacttgggaggctgaatggaataatcgggacggtttct 36173017  T
Q  212 caatccgccctat 224  Q
    |||||||||||||    
T  36173016 caatccgccctat 36173004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University