View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_517 (Length: 231)

Name: NF11453A_low_517
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_517
NF11453A_low_517
[»] chr3 (2 HSPs)
chr3 (1-137)||(11626413-11626548)
chr3 (181-225)||(11626323-11626367)


Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 11626548 - 11626413
Alignment:
Q  1 gctgacgtgtcaaacagcttttagcttaaacggatcaaaatccaattcctcgtgcactcatttcattgccaacatcgaaaaaaccgaaactctttcttca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11626548 gctgacgtgtcaaacagcttttagcttaaacggatcaaaatccaattcctcgtgcactcatttcattgccaacatcgaaaaaaccgaaactctttcttca 11626449  T
Q  101 aaacaaacagaaaccttaactaataactgtctcgcgc 137  Q
    |||||||||  ||||||||||||||||||||||||||    
T  11626448 aaacaaaca-taaccttaactaataactgtctcgcgc 11626413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 225
Target Start/End: Complemental strand, 11626367 - 11626323
Alignment:
Q  181 gatcttaagaaggaagaaatgattgaaactaaggaccctgaaatt 225  Q
    |||||||||||| || |||||||||||||||||||||||||||||    
T  11626367 gatcttaagaagaaaaaaatgattgaaactaaggaccctgaaatt 11626323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University