View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_397 (Length: 248)

Name: NF11453A_low_397
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_397
NF11453A_low_397
[»] chr2 (1 HSPs)
chr2 (59-231)||(3041972-3042145)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 59 - 231
Target Start/End: Original strand, 3041972 - 3042145
Alignment:
Q  59 agttaatagtcaaatctggaagtatatggataataaagtctactgcagactccatgcattttgttacttaactctattatctggttggtaaattattggt 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||| ||||    
T  3041972 agttaatagtcaaatctggaagtatatggataataaagtctactgtagaccccatgcattttgttacttaactctattatctggctggtaaattaatggt 3042071  T
Q  159 agttagtaacgttgtcgttcagat-nnnnnnnnctttatgtatacatcataaattcatagtcatatccagaata 231  Q
    ||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||    
T  3042072 agttagtaacgttgtcgttcagataaaaaaaaactttatgtatacatcataaattcatagtcatatccagaata 3042145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University