View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11453A_low_324 (Length: 263)

Name: NF11453A_low_324
Description: NF11453A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11453A_low_324
NF11453A_low_324
[»] chr7 (4 HSPs)
chr7 (1-204)||(8348795-8349000)
chr7 (35-215)||(8354820-8355000)
chr7 (35-193)||(8410525-8410695)
chr7 (176-247)||(8361416-8361487)
[»] chr3 (1 HSPs)
chr3 (186-221)||(30938593-30938628)


Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 8349000 - 8348795
Alignment:
Q  1 agtttgcatccactgcaagtagggcaatgtataaatttcttggctagtctagagctttgctagttttggatggtttttacttattattgcctactacaca 100  Q
    |||||||||||||| |||| |||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  8349000 agtttgcatccactacaagaagggaaaggtataaatttcttggctagtctacagctttgctagttttggatggtttttacttattattgcctactacaca 8348901  T
Q  101 --ttctcttaattaagctatagtttttaatatttgatttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattgacttt 198  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8348900 cattctcttaattaagctatagtttttaatatttgatttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattgacttt 8348801  T
Q  199 tagaag 204  Q
    ||||||    
T  8348800 tagaag 8348795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 35 - 215
Target Start/End: Complemental strand, 8355000 - 8354820
Alignment:
Q  35 atttcttggctagtctagagctttgctagttttggatggtttttacttattattgcctactacacattctcttaattaagctatagtttttaatatttga 134  Q
    |||||||||||| || | || |||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
T  8355000 atttcttggctactcaatagttttgctagttttggctggtttttacttattattgcttactacacattctcttaactaagctatagtttttaatatttga 8354901  T
Q  135 tttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattgacttttagaagtaggttacttt 215  Q
    |||||||||||||||||| |||||||||||| ||||| |||| |||||  ||||||||| |||||||| | ||||||||||    
T  8354900 tttgtgagcttatagctccgcatagagaaagaaaattgctggtttttggaatggaattggcttttagaggaaggttacttt 8354820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 35 - 193
Target Start/End: Complemental strand, 8410695 - 8410525
Alignment:
Q  35 atttcttggctagtctagagctttgctagttttggatggtttttacttatta-------ttgccta------ctacacattctcttaattaagctatagt 121  Q
    |||||||||||| |||| | ||||||||||||||| ||||||||||||||||       |||||||      ||||||||||||||||||||| ||||||    
T  8410695 atttcttggctactctataactttgctagttttggctggtttttacttattaattattattgcctatagctactacacattctcttaattaagatatagt 8410596  T
Q  122 ttttaatatttgatttgtgagcttatagctctgcatagagaaagcaaattcctgggttttgctatggaattg 193  Q
    ||||||| |||||||||||||| |||||||||||||||||||||| |||| |||| ||| | ||||||||||    
T  8410595 ttttaatgtttgatttgtgagc-tatagctctgcatagagaaagcgaattgctggatttgggtatggaattg 8410525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 176 - 247
Target Start/End: Complemental strand, 8361487 - 8361416
Alignment:
Q  176 ggttttgctatggaattgacttttagaagtaggttacttttctatgtcttgtccttacaggtgcaactttcc 247  Q
    ||||||| |||||| ||| |||||||| ||||||| | ||||||||||||||||||| | ||||||||||||    
T  8361487 ggttttggtatggagttggcttttagatgtaggtttcctttctatgtcttgtccttatatgtgcaactttcc 8361416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 30938628 - 30938593
Alignment:
Q  186 tggaattgacttttagaagtaggttacttttctatg 221  Q
    ||||||||||||||||| ||||||||||||||||||    
T  30938628 tggaattgacttttagaggtaggttacttttctatg 30938593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University