View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11446_low_65 (Length: 242)

Name: NF11446_low_65
Description: NF11446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11446_low_65
NF11446_low_65
[»] chr4 (2 HSPs)
chr4 (1-103)||(31848883-31848987)
chr4 (159-225)||(31848011-31848078)


Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 31848987 - 31848883
Alignment:
Q  1 ttaataaactgctgaaggagaaggtgctatgggatgatcctatgaaacatttagtaaaggttatgcaatgtaa--ctcttactgctggacacttatcatg 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||||||||||||||||||||    
T  31848987 ttaataaactgctgaaggagaaggtgctatgggatgatcctatgaaacatttagtaaaggttatgcaatgcaactctcttactgctggacacttatcatg 31848888  T
Q  99 attcg 103  Q
    |||||    
T  31848887 attcg 31848883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 225
Target Start/End: Complemental strand, 31848078 - 31848011
Alignment:
Q  159 taatggataacc-ttcaactaggtgatcagtggcaaacaattactatgcaactccaaataccgaaata 225  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31848078 taatggataacccttcaactaggtgatcagtggcaaacaattactatgcaactccaaataccgaaata 31848011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University