View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11442_low_4 (Length: 250)

Name: NF11442_low_4
Description: NF11442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11442_low_4
NF11442_low_4
[»] chr7 (2 HSPs)
chr7 (19-138)||(11019140-11019259)
chr7 (135-242)||(11018859-11018966)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 19 - 138
Target Start/End: Complemental strand, 11019259 - 11019140
Alignment:
Q  19 aaaatgtcatagagctcacaccaataaatcagatcagattgatatataaaggtaacagagaaaagtttacattagcaacataattaaaaatgcaaggttt 118  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11019259 aaaatgtcatagagctcacaccgataaatcagatcagattgatatataaaggtaacagagaaaagtttacattagcaacataattaaaaatgcaaggttt 11019160  T
Q  119 gtaacatgttcagtgtgaca 138  Q
    ||||||||||||||||||||    
T  11019159 gtaacatgttcagtgtgaca 11019140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 11018966 - 11018859
Alignment:
Q  135 gacaattttactctccgctcttctcttttccactcttgttgaacgtcgttctcaacttcatccttctattttcttccaatgtttttcattttgttcgatt 234  Q
    |||||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  11018966 gacaattttactctccgctcttctcttttccactctcgttgaatgttgctctcaacttcatccttctattttcttccaatgtttttcatttcgttcgatt 11018867  T
Q  235 ttcttctc 242  Q
    ||||||||    
T  11018866 ttcttctc 11018859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University