View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11439_low_8 (Length: 213)

Name: NF11439_low_8
Description: NF11439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11439_low_8
NF11439_low_8
[»] chr8 (1 HSPs)
chr8 (29-200)||(36357284-36357455)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 29 - 200
Target Start/End: Original strand, 36357284 - 36357455
Alignment:
Q  29 tatatgcatgaaatccagatgaaaaatcatgacacatataaatacttgaagaaatgttacataaacttcaatgtgacaggtataattgtaccaaatttta 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36357284 tatatgcatgaaatccagatgaaaaatcatgacacatataaatacttgaagaaatgttacataaacttcaatgtgacaggtataattgtaccaaatttta 36357383  T
Q  129 gataaatataattgaattaaaagagcttgacattataccaactgttttccagtctcattgcggatctctgct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||    
T  36357384 gataaatataattgaattaaaagagcttgacattataccaactgtgttccagtctcattgcggatccctgct 36357455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University