View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11433_low_20 (Length: 387)

Name: NF11433_low_20
Description: NF11433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11433_low_20
NF11433_low_20
[»] chr2 (2 HSPs)
chr2 (274-380)||(26324471-26324576)
chr2 (191-228)||(26324322-26324359)


Alignment Details
Target: chr2 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 274 - 380
Target Start/End: Original strand, 26324471 - 26324576
Alignment:
Q  274 atcacgggtgaaaaaatatcataaggacgactcaccgttcgtctcctttccaaaaatccttttgttttggacctttaggcccttcccttggaccccaatt 373  Q
    |||||||||||||||  |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26324471 atcacgggtgaaaaac-atcataagaacgactcaccgttcgtctcctttccaaaaatccttttgttttggacctttaggcccttcccttggaccccaatt 26324569  T
Q  374 catctca 380  Q
    |||||||    
T  26324570 catctca 26324576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 191 - 228
Target Start/End: Original strand, 26324322 - 26324359
Alignment:
Q  191 attattacaaggcctaattgagatataaaatttctacc 228  Q
    |||||||||| |||||||||||||||||||||||||||    
T  26324322 attattacaaagcctaattgagatataaaatttctacc 26324359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University