View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1142_high_5 (Length: 308)

Name: NF1142_high_5
Description: NF1142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1142_high_5
NF1142_high_5
[»] chr1 (1 HSPs)
chr1 (68-142)||(43571416-43571490)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 68 - 142
Target Start/End: Complemental strand, 43571490 - 43571416
Alignment:
Q  68 ttatacttatggtggtgatataactaatcaaatagtacatattaacgataactcaaattagtgcacgtgttaagg 142  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  43571490 ttatacttatggtggtgatataactaatcaaatagtacatgttaacgataactcaaattagtgcacgtgttaagg 43571416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University