View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11429_low_2 (Length: 282)

Name: NF11429_low_2
Description: NF11429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11429_low_2
NF11429_low_2
[»] chr4 (1 HSPs)
chr4 (3-263)||(21445148-21445396)


Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 3 - 263
Target Start/End: Original strand, 21445148 - 21445396
Alignment:
Q  3 ttgaggaggagcagagaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgat 102  Q
    |||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21445148 ttgaggagcaccagaaaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgat 21445247  T
Q  103 agtttcttctcactcttttcagcaagtaacgaaggataagcgcaaaagggttcttgagatgccactgctattggcaccgctattggcaccggctcacttc 202  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||    
T  21445248 agtttcttctcactcttttctgcaagtaacgaaggataagcgcaaaagggttcttgagatgccact------------gctattggcaccggctcacttc 21445335  T
Q  203 tagttctaaggaattggtcgagattttggcggtatttaatcccatggattttagctccaag 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21445336 tagttctaaggaattggtcgagattttggcggtatttaatcccatggattttagctccaag 21445396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University