View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11428_high_16 (Length: 305)

Name: NF11428_high_16
Description: NF11428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11428_high_16
NF11428_high_16
[»] chr3 (1 HSPs)
chr3 (1-296)||(43129176-43129471)


Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 43129176 - 43129471
Alignment:
Q  1 taccggcccatcatttcatctcattcagcctgatatctcatgcaaatttgcccctgttaacccgggctacgccgcttgtcttgataaaacccgaaaagac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43129176 taccggcccatcatttcatctcattcagcctgatatctcatgcaaatttgcccctgttaacccgggctacgccgcttgtcttgataaaacccgaaaagac 43129275  T
Q  101 ttgatcgtcgcaaccgtggcttcttccctcattggttgcttcatcatgggtgcttttgctaatctcccattaggccttgctccaggtatgggctcaaacg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43129276 ttgatcgtcgcaaccgtggcttcttccctcattggttgcttcatcatgggtgcttttgctaatctcccattaggccttgctccaggtatgggctcaaacg 43129375  T
Q  201 cttacttcgcttacaccgtcgtgggctttcacggttccggcactatctcctaccaaagcgcactcgcagcagttttcattgaaggattgttcttct 296  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  43129376 cttacttcgcttacaccgtcgtgggctttcacggttccggcactatctcctaccaaagcgcactcgcagcagttttcattgaaggaatgttcttct 43129471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University