View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11420_high_30 (Length: 240)

Name: NF11420_high_30
Description: NF11420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11420_high_30
NF11420_high_30
[»] chr8 (1 HSPs)
chr8 (1-224)||(40727117-40727340)


Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 40727340 - 40727117
Alignment:
Q  1 tagcgacacataatgattttcgtatttcctgtattgaatttttcagatgcttgttgctacacctggtaggttactggatcatattgagaataagaccgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40727340 tagcgacacataatgattttcgtatttcctgtattgaatttttcagatgcttgttgctacacctggtaggttactggatcatattgagaataagaccgga 40727241  T
Q  101 atatctgtacgactgatgggcttgcagatgcttatacttgacgaagctgatcatttgctggaccttgggtttcgaaaggatatagaaaaaattgttgact 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40727240 atatctgtacgagtgatgggcttgcagatgcttatacttgacgaagctgatcatttgctggaccttgggtttcgaaaggatatagaaaaaattgttgact 40727141  T
Q  201 gtttaccccgtcaaagacaatcct 224  Q
    ||||||||||||||||||||||||    
T  40727140 gtttaccccgtcaaagacaatcct 40727117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University