View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1140_low_54 (Length: 207)

Name: NF1140_low_54
Description: NF1140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1140_low_54
NF1140_low_54
[»] chr3 (1 HSPs)
chr3 (1-97)||(42443045-42443141)


Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 42443045 - 42443141
Alignment:
Q  1 ggggttgaaattgaggatatcgatgcggtttgtgtattcttcgatgaagcttccgacggcgatacgttgttgtggggaatttgtgttgggagagatg 97  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42443045 ggggttgaaattgagaatatcgatgcggtttgtgtattcttcgatgaagcttccgacggcgatacgttgttgtggggaatttgtgttgggagagatg 42443141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University