View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1140_low_40 (Length: 283)

Name: NF1140_low_40
Description: NF1140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1140_low_40
NF1140_low_40
[»] chr1 (1 HSPs)
chr1 (62-222)||(6451364-6451524)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 62 - 222
Target Start/End: Original strand, 6451364 - 6451524
Alignment:
Q  62 attaaataacatctctgcgtctgcatcatgtggctctgtgacatggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt 161  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6451364 attaaataacatctctgcgtctgcatcatgtggctctgtgacctggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt 6451463  T
Q  162 aattttcttcccagtttctgatcagttacccatttttgctctcttcaatttgggggtatct 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6451464 aattttcttcccagtttctgatcagttacccatttttgctctcttcaatttgggggtatct 6451524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University