View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_low_222 (Length: 238)

Name: NF1139_low_222
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_low_222
NF1139_low_222
[»] chr1 (2 HSPs)
chr1 (54-229)||(12104984-12105159)
chr1 (1-41)||(12105597-12105637)


Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 54 - 229
Target Start/End: Complemental strand, 12105159 - 12104984
Alignment:
Q  54 taaatatatagggttaaaattactttattttatttttagtttaactcaaccgacaaagttgatattgttactagtgcagcggagttcaaaacctagatct 153  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  12105159 taaatatatagggttaaaattactttattttatttttagtttaactcaaccgacaaagttgatattgttaccagtgcagcggagttcaaaacctagatct 12105060  T
Q  154 cgcttttgtgtgtgaattttgaatagtatttgtcaattcgtctacagatgttatatagattatctcaaagtattat 229  Q
    ||||||| | ||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||    
T  12105059 cgcttttatttgtgagttttgaatagtatttgtcaattcgtctatagatgttatatagattatctcgaagttttat 12104984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 12105637 - 12105597
Alignment:
Q  1 ggagatcatgaaagatgagagtgagatgttgaataatgaga 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  12105637 ggagatcatgaaagatgagagtgagatgttgaataatgaga 12105597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University