View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_low_176 (Length: 259)

Name: NF1139_low_176
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_low_176
NF1139_low_176
[»] chr2 (2 HSPs)
chr2 (152-259)||(45104294-45104401)
chr2 (30-90)||(45104463-45104523)


Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 152 - 259
Target Start/End: Complemental strand, 45104401 - 45104294
Alignment:
Q  152 ttggttcctgcagaatatctcatttgacaaagacattacgatatataaatactgaagtttgaactttagattttccgcatatttatcttaagtaaatttc 251  Q
    |||||| | ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  45104401 ttggttacagcagaatatctcagttgacaaagacattgcgatatataaatactgaagtttgaactttagattttccgcttatttatcttaagtaaatttc 45104302  T
Q  252 caatttct 259  Q
    ||||||||    
T  45104301 caatttct 45104294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 30 - 90
Target Start/End: Complemental strand, 45104523 - 45104463
Alignment:
Q  30 tctctcagaatgataatgacagtatctctgttgaaacagagtttagcagaatgcatacggt 90  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45104523 tctctcagaatgataatgacagtatctctgttgaaacagagtttagcagaatgcatacggt 45104463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University