View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_high_198 (Length: 223)

Name: NF1139_high_198
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_high_198
NF1139_high_198
[»] chr2 (1 HSPs)
chr2 (18-98)||(35967199-35967279)


Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 35967279 - 35967199
Alignment:
Q  18 agtttgtgatgtattttgtgtcgctatgttgttttcttgaacttggttgatggatactttttaaatcctttccttacccat 98  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||| |||| |||||||||||||    
T  35967279 agtttgtgatgtattttgtgtcactatcttgttttcttgaacttggttgatggatattttttgaatcatttccttacccat 35967199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University