View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11391_low_17 (Length: 402)

Name: NF11391_low_17
Description: NF11391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11391_low_17
NF11391_low_17
[»] chr4 (1 HSPs)
chr4 (128-387)||(34666694-34666955)


Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 128 - 387
Target Start/End: Original strand, 34666694 - 34666955
Alignment:
Q  128 gtgaatggaattgatttcagaagaagccacctcaagggaattgatttcagaagaagcccgtgaatggagttgatttcaatcgcatacaaaaataacttat 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  34666694 gtgaatggaattgatttcagaagaagccacctcaagggaattgatttcagaagaagcccgttaatggagttgatttcaatcgcatacaaaaataacttat 34666793  T
Q  228 tattttgcatnnnnnnnnn--ttacttttcttctttctacttcttctcttatctccgagtcctttctctccatgtgccaggttattaatttcaattgtac 325  Q
    ||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  34666794 tattttgcataaaaaaaaaaattacttttcttctttctacttcttctcttatctccgagtcctttctctccatgtgctaggttattaatttcaattgtac 34666893  T
Q  326 gtgaatggaattcattgatccggaagtaaaatgatcagatttatttctatgatcgttggaat 387  Q
    |||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||    
T  34666894 gtgaatggaattcattgaaccggaagtaaaatgatcagatttgtttctatgatcgttggaat 34666955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University