View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11386A_low_520 (Length: 216)

Name: NF11386A_low_520
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11386A_low_520
NF11386A_low_520
[»] chr8 (1 HSPs)
chr8 (17-181)||(39079370-39079536)


Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 17 - 181
Target Start/End: Complemental strand, 39079536 - 39079370
Alignment:
Q  17 caatatcctcaactgagaaaatgttattattcaaatcgacataaccaataaatctattggttaagtgactatggtttatgttcaatnnnnnnnntgtggt 116  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||        ||||||    
T  39079536 caatatcctcaactaagaaaatgttattattcaaatcgacataaccaataaatctagtggttaagtgactatggtttatgttcaat-aaaaaaatgtggt 39079438  T
Q  117 tgctaaccttgttatagcaccggacaactcaaacc---tgaaattcttccggttcatcccaggtttga 181  Q
    |||||||||||||||||||| ||||||||||||||   ||||||||||||||||||||||||||||||    
T  39079437 tgctaaccttgttatagcactggacaactcaaacctgatgaaattcttccggttcatcccaggtttga 39079370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University