View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11386A_low_482 (Length: 227)

Name: NF11386A_low_482
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11386A_low_482
NF11386A_low_482
[»] chr7 (3 HSPs)
chr7 (20-207)||(12487632-12487819)
chr7 (20-166)||(12541448-12541599)
chr7 (38-166)||(12509274-12509402)
[»] chr3 (2 HSPs)
chr3 (106-186)||(34498884-34498964)
chr3 (106-186)||(27610409-27610489)
[»] chr4 (1 HSPs)
chr4 (104-196)||(40554379-40554471)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 12487632 - 12487819
Alignment:
Q  20 atggaaaattgacaatgcggtcttagtttgttttaaagtctgtcagtcaagttcaatacagtgttttcgaatgtcggccatggtggatattggtggctat 119  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  12487632 atggaaaattgacaatgtggtcttagtttgttttaaagtctgtcagtcaagttcaatacagtgttttcgaatgtcggccatggtgcatattggtggctat 12487731  T
Q  120 ttttgggctcgcccccatggtaaatatcggctgatgttgtaggtttttccgccataatcctctatgacggcaccacagggcagccagt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12487732 ttttgggctcgcccccatggtaaatatcggctgatgttgtaggtttttccgccataatcctctatgacggcaccacagggcagccagt 12487819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 166
Target Start/End: Original strand, 12541448 - 12541599
Alignment:
Q  20 atggaaaattgacaatgcggtcttagtttgttttaaagtctgtcagtcaagttcaat-----acagtgttttcgaatgtcggccatggtggatattggtg 114  Q
    ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||| |||||| ||||    
T  12541448 atggaaaattgacaacgtggtcttagtttgttttaaagtctgtcagtcaagttcaatacaatacagtgttttcgaatgtcggccatggaggatatcggtg 12541547  T
Q  115 gctatttttgggctcgcccccatggtaaatatcggctgatgttgtaggtttt 166  Q
    || ||||||||||| |||| | | |||||||||| |||| ||||||||||||    
T  12541548 gcgatttttgggcttgccctctttgtaaatatcgactgacgttgtaggtttt 12541599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 38 - 166
Target Start/End: Original strand, 12509274 - 12509402
Alignment:
Q  38 ggtcttagtttgttttaaagtctgtcagtcaagttcaatacagtgttttcgaatgtcggccatggtggatattggtggctatttttgggctcgcccccat 137  Q
    ||||||| | ||||||||||| ||  ||||||||||||| | ||||| |||||| |||||||||| |||||| |||||| ||||||||||| |||||| |    
T  12509274 ggtcttattatgttttaaagtttgagagtcaagttcaatcctgtgttatcgaatatcggccatggaggatatcggtggcgatttttgggcttgccccctt 12509373  T
Q  138 ggtaaatatcggctgatgttgtaggtttt 166  Q
     ||| |||||| |||| ||||||||||||    
T  12509374 cgtagatatcgactgacgttgtaggtttt 12509402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 34498964 - 34498884
Alignment:
Q  106 atattggtggctatttttgggctcgcccccatggtaaatatcggctgatgttgtaggtttttccgccataatcctctatga 186  Q
    |||| ||||||  |||||||||||||| | ||||||||||||||  ||| ||| |||| |||||  |||||||||||||||    
T  34498964 atatcggtggcggtttttgggctcgccgcaatggtaaatatcggtcgatattgcaggtctttccagcataatcctctatga 34498884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 27610489 - 27610409
Alignment:
Q  106 atattggtggctatttttgggctcgcccccatggtaaatatcggctgatgttgtaggtttttccgccataatcctctatga 186  Q
    |||| ||||||  |||||||||||||| | ||||||||||||||   || ||| |||| |||||  |||||||||||||||    
T  27610489 atatcggtggcggtttttgggctcgccgcaatggtaaatatcggtcaatattgcaggtctttccagcataatcctctatga 27610409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 196
Target Start/End: Complemental strand, 40554471 - 40554379
Alignment:
Q  104 ggatattggtggctatttttgggctcgcccccatggtaaatatcggctgatgttgtaggtttttccgccataatcctctatgacggcaccaca 196  Q
    |||||| |||||| |||||||||||| || |||||   ||| ||||||||| | | ||| ||||||||||| ||||  ||||||||| |||||    
T  40554471 ggatatcggtggcaatttttgggctctccgccatgcccaatttcggctgatatggcaggattttccgccatgatccgatatgacggcgccaca 40554379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University