View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11386A_low_417 (Length: 234)

Name: NF11386A_low_417
Description: NF11386A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11386A_low_417
NF11386A_low_417
[»] scaffold1030 (2 HSPs)
scaffold1030 (35-153)||(2018-2136)
scaffold1030 (149-232)||(2252-2335)
[»] chr6 (2 HSPs)
chr6 (35-153)||(14279400-14279519)
chr6 (152-203)||(14279230-14279281)


Alignment Details
Target: scaffold1030 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: scaffold1030
Description:

Target: scaffold1030; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 35 - 153
Target Start/End: Original strand, 2018 - 2136
Alignment:
Q  35 ggtgtttatttggtctcatttgtgagaagagaacattaggtgctactataggtgttttggttggttttaattgtttcttaaaaggtttttggtacgaata 134  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||    
T  2018 ggtgtttatttggtctcatttgtgcgaagagaacattaggtgctactataggtgttttggttggttttaattgtttttttaaaggtttttggtacaaata 2117  T
Q  135 gcatatgataggtgtttag 153  Q
    |||||||||||||||||||    
T  2118 gcatatgataggtgtttag 2136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1030; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 149 - 232
Target Start/End: Original strand, 2252 - 2335
Alignment:
Q  149 tttagtggtgtggtgatgtaggagatgtaagggttttctgtgcttattttactatatatgttctttttgtttttcaggtctatg 232  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||    
T  2252 tttagtggtgtcgtgatgtaggagatgtaagggttttctgtgcgtattttactatatatgttctttttgttttccaggtctatg 2335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 35 - 153
Target Start/End: Complemental strand, 14279519 - 14279400
Alignment:
Q  35 ggtgtttatttggtctcatttgtgagaagagaacattaggtgctactataggtgttttggttggttttaattg-tttcttaaaaggtttttggtacgaat 133  Q
    |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||| ||| || ||||||||||| |||||||    
T  14279519 ggtgtttatttggtctcatttgtgcgaagagaacattaggtgctagtataggtgttttggtcggttttaattgttttttttaaaggtttttgatacgaat 14279420  T
Q  134 agcatatgataggtgtttag 153  Q
    |||||||||||| |||||||    
T  14279419 agcatatgatagctgtttag 14279400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 152 - 203
Target Start/End: Complemental strand, 14279281 - 14279230
Alignment:
Q  152 agtggtgtggtgatgtaggagatgtaagggttttctgtgcttattttactat 203  Q
    ||||||||| ||||||| |||||||||||||||||||||| |||||||||||    
T  14279281 agtggtgtgttgatgtatgagatgtaagggttttctgtgcgtattttactat 14279230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University