View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11385A_low_67 (Length: 346)

Name: NF11385A_low_67
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11385A_low_67
NF11385A_low_67
[»] chr8 (1 HSPs)
chr8 (100-335)||(29578242-29578477)


Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 100 - 335
Target Start/End: Original strand, 29578242 - 29578477
Alignment:
Q  100 gaagattggaacatgcttgctgctgattgtgttgtcatatcttgctgctgccaatgcttggttctgcaaattcttgtgcttgtattgcgaaagatggtga 199  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29578242 gaagattggaacatgcttgctgctgattgtgttgtcatatcatgctgctgccaatgcttggttctgcaaattcttgtgcttgtattgcgaaagatggtga 29578341  T
Q  200 gaaaaacaagagaatatggtaagaaaatattttgtcaaaggaaggggaattatagaggggtgcaaagagaaatgggatcttataaagatgtggttttgag 299  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  29578342 gaaaaacaagagaatatggtaagaaaatattttgtcaaaggaaggggaattatagaggggtgcaaagagaaatggggtcttataaagatgtggttttgag 29578441  T
Q  300 aattcaagaagattacgcactaaaagatgatgatgt 335  Q
    ||||||||||||||| ||||||||||||||||||||    
T  29578442 aattcaagaagattatgcactaaaagatgatgatgt 29578477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University