View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11385A_low_297 (Length: 229)

Name: NF11385A_low_297
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11385A_low_297
NF11385A_low_297
[»] chr4 (3 HSPs)
chr4 (5-98)||(17432636-17432729)
chr4 (154-229)||(17432502-17432577)
chr4 (160-215)||(17436400-17436455)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 5 - 98
Target Start/End: Complemental strand, 17432729 - 17432636
Alignment:
Q  5 atgagatttagggtgtcggacataacaataacaatttgtttctttgtaacaatatgcaacctataagaagataaaagttcaacttataccctag 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17432729 atgagatttagggtgtcggacataacaataacaatttgtttctttgtaacaatatgcaacctataagaagataaaagttcaacttataccctag 17432636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 154 - 229
Target Start/End: Complemental strand, 17432577 - 17432502
Alignment:
Q  154 ggtacatatataaagcttgtcagatatcatacatccatatgatattatttaccaacaagcatatacataattttct 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17432577 ggtacatatataaagcttgtcagatatcatacatccatatgatattatttaccaacaagcatatacataattttct 17432502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 215
Target Start/End: Complemental strand, 17436455 - 17436400
Alignment:
Q  160 tatataaagcttgtcagatatcatacatccatatgatattatttaccaacaagcat 215  Q
    ||||||||||||||  || |||||||||||||||||||||||  | ||||||||||    
T  17436455 tatataaagcttgtatgacatcatacatccatatgatattatacatcaacaagcat 17436400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University