View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11385A_low_270 (Length: 233)

Name: NF11385A_low_270
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11385A_low_270
NF11385A_low_270
[»] chr4 (2 HSPs)
chr4 (115-218)||(26417844-26417947)
chr4 (4-78)||(26417722-26417807)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 115 - 218
Target Start/End: Original strand, 26417844 - 26417947
Alignment:
Q  115 cctaacgtgcatttttccttcaagcgaattgcattgaaccgagcttctaaattcttcttctgatgaataatggactcgaatgtatcatgcttcaagatcg 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  26417844 cctaacgtgcatttttccttcaagcgaattgcattgaaccgagcttctaaattcttcttctgatgaataatggactcgaatgtataatgcttcaagatcg 26417943  T
Q  215 tgat 218  Q
    ||||    
T  26417944 tgat 26417947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 78
Target Start/End: Original strand, 26417722 - 26417807
Alignment:
Q  4 gtgctttcagtgagattttgacaccgactcaaagaatgcaat-----------gtatcaagcccttaatgataattatcacttgtt 78  Q
    ||||||| | |||||||||||||| |||||||||||||||||           |||||||||||||||||||||||| ||||||||    
T  26417722 gtgcttttattgagattttgacactgactcaaagaatgcaatttacttttatcgtatcaagcccttaatgataattaccacttgtt 26417807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University