View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11385A_low_203 (Length: 249)

Name: NF11385A_low_203
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11385A_low_203
NF11385A_low_203
[»] chr3 (1 HSPs)
chr3 (16-249)||(54877398-54877632)
[»] chr8 (1 HSPs)
chr8 (72-104)||(18322943-18322975)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 249
Target Start/End: Original strand, 54877398 - 54877632
Alignment:
Q  16 aacggttgttcatggttctccggtgtggcggaggttgaatcttcaagatggaggagtgcagacatattaacactccaacgctcaagtcaatatttgtggt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||    
T  54877398 aacggttgttcatggttctccggtgtggcggaggttgaatcttcaaggtggaggagtgcagacatattaacactccaacgctcaagtcagtatttatggt 54877497  T
Q  116 tatgtgcagaagtgtaccttgagggtg-cgttgaatcatccttatatagacgtagagagcgctaacggttcccgcaaagtgtggcgcaatcttaggaggt 214  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||| ||||    
T  54877498 tatgtgcagaagtgtaccttgagggtgtcgttgaatcatccttatatagatgtagagagtgctaacggttcccacaaagtgtggcgcaatcttagaaggt 54877597  T
Q  215 cgttagagattacgtggacggtggagatgtagtca 249  Q
    ||||||||||||||||||||||||| ||| |||||    
T  54877598 cgttagagattacgtggacggtggatatggagtca 54877632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 18322943 - 18322975
Alignment:
Q  72 tgcagacatattaacactccaacgctcaagtca 104  Q
    ||||||||| |||||||||||||||||||||||    
T  18322943 tgcagacatgttaacactccaacgctcaagtca 18322975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University