View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11385A_high_37 (Length: 213)

Name: NF11385A_high_37
Description: NF11385A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11385A_high_37
NF11385A_high_37
[»] chr5 (1 HSPs)
chr5 (23-192)||(35154331-35154498)


Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 23 - 192
Target Start/End: Complemental strand, 35154498 - 35154331
Alignment:
Q  23 catcatacctgtatagtcttagagtctcttgtatttttgtgtgaatttagttcgttcatatgtgtccctttgtttataagcttttagtagctgctctttg 122  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||  ||||| |||||||||||||||||||||||||||||||||    
T  35154498 catcatacctgtatagtcttagggtctcttgtatttttgtgtgaatttagttcattcat--gtgtctctttgtttataagcttttagtagctgctctttg 35154401  T
Q  123 tacgttttttatgtatcgacgatcactccttgtgctcgtcagtatcaagccttacgtacatattcgaatt 192  Q
    |||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||| |||||| ||||    
T  35154400 tacgttttttatgtattgacgatcactccttgtcctcgtcagtatcaagtcttacgtatatattcaaatt 35154331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University