View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11383_low_13 (Length: 250)

Name: NF11383_low_13
Description: NF11383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11383_low_13
NF11383_low_13
[»] chr2 (1 HSPs)
chr2 (1-237)||(15051389-15051625)


Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 15051389 - 15051625
Alignment:
Q  1 cggctgcgattcctttctgtgagtttagagtatacaacttgtactcaaagactacggtccagattataatgttaccccagttgctcttgtttcgctcgag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15051389 cggctgcgattcctttctgtgagtttagagtatacaacttgtactcaaagactacggtccagattataatgttaccccagttgctcttgtttcgctcgag 15051488  T
Q  101 caacctattcacttatcattaactatgagttatgcccaacaggttgattgagttgagtgagtgaatgttgtttccaaggttttgaataaaggttcttaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15051489 caacctattcacttatcattaactatgagttatgcccaacaggttgattgagttgagtgagtgaatgttgtttccaaggttttgaataaaggttcttaat 15051588  T
Q  201 tgatattgcaactgcaatgtgaaagttttagagacct 237  Q
    |||||||||||||||||||||||||||||||||||||    
T  15051589 tgatattgcaactgcaatgtgaaagttttagagacct 15051625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University