View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1137_low_187 (Length: 245)

Name: NF1137_low_187
Description: NF1137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1137_low_187
NF1137_low_187
[»] chr8 (1 HSPs)
chr8 (1-125)||(35814460-35814584)


Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 35814460 - 35814584
Alignment:
Q  1 aacaacaaccactaagcaggtatgaatctcaaaaacgtagagattggaacacctttaatcaatatctcaagagtcaaaatccactagttccactatcaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35814460 aacaacaaccactaagcaggtatgaatctcaaaaacgtagagattggaacacctttaatcaatatctcaagagtcaaaatccactagttccactatcaca 35814559  T
Q  101 ctgtaacttcaaccatgttcttgat 125  Q
    |||||||||||||||||||||||||    
T  35814560 ctgtaacttcaaccatgttcttgat 35814584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University