View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11375_low_23 (Length: 388)

Name: NF11375_low_23
Description: NF11375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11375_low_23
NF11375_low_23
[»] chr4 (3 HSPs)
chr4 (1-231)||(4669836-4670066)
chr4 (210-372)||(4670688-4670859)
chr4 (268-372)||(4670064-4670160)
[»] chr6 (1 HSPs)
chr6 (104-239)||(10872953-10873093)


Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 4669836 - 4670066
Alignment:
Q  1 atgccctatttgttggttgatttgctggattttttaacatattcaatcttttcctggccggttcatcatccataccatcttctggtacccctataacttt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||    
T  4669836 atgccctatttgttggttgatttgctggattttttaacatattcaatcttttcctggctggttcatcatccataccatcttttggtacccctataacttt 4669935  T
Q  101 ttgtttctcttttgaaggagctcattctttcatcacatggttgtagcatccccaatgcatacaaattatgtgtagacccaccatgtattgcacttggtac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  4669936 ttgtttctcttttgaaggagctcattctttcatcacatggttgtagcatccccaatgcatacaaattatatgtagacccaccatgtattgcacttggtac 4670035  T
Q  201 cactgtccctttatccctacacgaccaacaa 231  Q
    |||||||||||||||||||||||||||||||    
T  4670036 cactgtccctttatccctacacgaccaacaa 4670066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 210 - 372
Target Start/End: Original strand, 4670688 - 4670859
Alignment:
Q  210 tttatccctacacgaccaacaatcgtctttgcaaggtaagcttccatgcacatacgcgcaaaccttcacaagcaacattcaaggtttgaagatcaac--- 306  Q
    |||| ||||||||||||||||||||||| ||  ||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||       
T  4670688 tttaaccctacacgaccaacaatcgtctgtg--aggtaagcttccatgcacatatgtgcaaaccttcacaagcaaccttcaaggtttgaagatcaacttt 4670785  T
Q  307 -------ttgccgaccattgagaccatagtccacaaaacacttttgtca-caaaaaacaaggtttaggttcata 372  Q
           ||| ||||| |||||||   |||||| |||||||||||||||  |||||||||||||||||||||||    
T  4670786 aaaatggttgtcgacctttgagactgaagtccaaaaaacacttttgtcataaaaaaacaaggtttaggttcata 4670859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 268 - 372
Target Start/End: Original strand, 4670064 - 4670160
Alignment:
Q  268 caaaccttcacaagcaacattcaaggtttgaagatcaacttgccgaccattgagaccatagtccacaaaacacttttgtcac-aaaaaacaaggtttagg 366  Q
    ||||||||||||||| ||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||| |||||||||||||||||    
T  4670064 caaaccttcacaagccacattcaaggtttgaagatcaacttgcc---------gaccatagtccacaaaacacttttgtcacaaaaaaacaaggtttagg 4670154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 104 - 239
Target Start/End: Original strand, 10872953 - 10873093
Alignment:
Q  104 tttctcttttgaaggagctcattctttcatcacatggttgtag--------catccccaatgcatacaaattatgtgtagacccaccatgtattgcactt 195  Q
    |||||||||||||||||| || |||||||||||||||| ||||        ||||| |||| |||||||||||||||||||||| |   |||||||||||    
T  10872953 tttctcttttgaaggagcacactctttcatcacatggtcgtagactcatagcatccacaatacatacaaattatgtgtagaccctc---gtattgcactt 10873049  T
Q  196 ggtaccactgtccctttatccctacacgaccaacaatcgtcttt 239  Q
    ||||| ||| ||| |||||||| |||| ||||||||| ||||||    
T  10873050 ggtactactctccatttatccccacacaaccaacaatagtcttt 10873093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University