View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1136_low_12 (Length: 273)

Name: NF1136_low_12
Description: NF1136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1136_low_12
NF1136_low_12
[»] chr1 (1 HSPs)
chr1 (52-224)||(18325494-18325666)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 52 - 224
Target Start/End: Complemental strand, 18325666 - 18325494
Alignment:
Q  52 atacttcccgatacacgcgagaggatgctggcaacagaagtaactgcactatggaggtaatttcttttttctgtactgagtcttagcctatacttggttc 151  Q
    |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||| |||||||    
T  18325666 atacttcctgatacacgcgagaggatgctggcaacagaagtaactgcgctatggaggtaatttcttttttctgtactgagtgttggcctatatttggttc 18325567  T
Q  152 aatgtttgtagcagccggaatcaattctaaaggtgtaaaattttgccatgtttggttgctctctcgagtagaa 224  Q
    ||| |||||||| || |||||  ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18325566 aatatttgtagctgctggaattgattctaaaggtgtaaaattttgccatgtttggttgctctctcgagtagaa 18325494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University