View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11362_high_23 (Length: 223)

Name: NF11362_high_23
Description: NF11362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11362_high_23
NF11362_high_23
[»] chr1 (3 HSPs)
chr1 (73-209)||(7166946-7167082)
chr1 (75-179)||(7160310-7160414)
chr1 (17-52)||(7166887-7166922)


Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 73 - 209
Target Start/End: Original strand, 7166946 - 7167082
Alignment:
Q  73 ggacctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaa 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7166946 ggacctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaa 7167045  T
Q  173 cagtttcggccatagaacccatattttattttctctg 209  Q
    |||||||||||||||||||||||||||||||||||||    
T  7167046 cagtttcggccatagaacccatattttattttctctg 7167082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 75 - 179
Target Start/End: Original strand, 7160310 - 7160414
Alignment:
Q  75 acctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaaca 174  Q
    |||||||||||| || || ||||||||  |||| |||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||     
T  7160310 acctgggtcgcgcacggtggctcgaactgtgtagccgcgctccataagtctcataacaagccacgacccgatgaaacctgaagcccctgtgacgcaaact 7160409  T
Q  175 gtttc 179  Q
    |||||    
T  7160410 gtttc 7160414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 7166887 - 7166922
Alignment:
Q  17 attgatttatacatgatatgaaaaatgttgcaacat 52  Q
    ||||||||||||||||||||||||||||||||||||    
T  7166887 attgatttatacatgatatgaaaaatgttgcaacat 7166922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University