View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11350_low_5 (Length: 242)

Name: NF11350_low_5
Description: NF11350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11350_low_5
NF11350_low_5
[»] chr6 (1 HSPs)
chr6 (24-227)||(21368807-21369011)


Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 24 - 227
Target Start/End: Complemental strand, 21369011 - 21368807
Alignment:
Q  24 gcacaaaatttgaaaatggagctctac-accaacggaacaatgaatctaacagatcaattgggaaaatggcagggagctacttctcaatacacagatatg 122  Q
    |||||||||||||||||||||| |||| |||| | |||||||||||||| ||||||||||||||||||||||||| ||||||||| |||||| |||||||    
T  21369011 gcacaaaatttgaaaatggagccctaccaccagcagaacaatgaatctagcagatcaattgggaaaatggcagggggctacttctgaatacatagatatg 21368912  T
Q  123 tcatcacctaaatcatccatacctgactttaatttcttattaagtgcccaatcgagggctttctgaagtggtttagtcaaagaaggtaccacagagctgg 222  Q
    |||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||| |||||||||| |||||||||  ||||||||| |||||    
T  21368911 tcatcacctaaatcatccatacctgactttgatgtctcattaagtgcccaatcgagggctttatgaagtggttcagtcaaagacagtaccacagggctgg 21368812  T
Q  223 agtag 227  Q
    |||||    
T  21368811 agtag 21368807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University