View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11342_low_34 (Length: 206)

Name: NF11342_low_34
Description: NF11342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11342_low_34
NF11342_low_34
[»] chr4 (1 HSPs)
chr4 (24-129)||(32266717-32266822)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 24 - 129
Target Start/End: Complemental strand, 32266822 - 32266717
Alignment:
Q  24 tttgtgttgctgctacaacaatgaatctaaggaaatctaagagaagagttaggttcaagtctattactctttcaaatcatcaaccttcttcttcttctgt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  32266822 tttgtgttgctgctacaacaatgaatctaaggaaatctaagagaagaattaggttcaagtctattactctttcaaatcagcaaccttcttcttcttctgt 32266723  T
Q  124 taatgg 129  Q
    ||||||    
T  32266722 taatgg 32266717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University