View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1133_high_30 (Length: 264)

Name: NF1133_high_30
Description: NF1133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1133_high_30
NF1133_high_30
[»] chr3 (2 HSPs)
chr3 (43-187)||(46582485-46582629)
chr3 (205-241)||(46582700-46582736)


Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 43 - 187
Target Start/End: Original strand, 46582485 - 46582629
Alignment:
Q  43 tcaatacctatgagggtaaatgaaactagcaccacttcacttcctgcaacacctatcaatactcagcaagaaactagacaagaagaacaatcttctcaga 142  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46582485 tcaatacctatgagagtaaatgaaactagcaccacttcacttcctgcaacacctatcaatactcagcaagaaactagacaagaagaacaatcttctcaga 46582584  T
Q  143 actctccacctaacacttgatttagtttctttgtgttacttgaag 187  Q
    ||||||||||||||||||||||||||||||||||| |||||||||    
T  46582585 actctccacctaacacttgatttagtttctttgtgctacttgaag 46582629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 46582700 - 46582736
Alignment:
Q  205 gcactgattcatatagttacattcaatgaattcatct 241  Q
    |||||||||||||||||||||||||||||||||||||    
T  46582700 gcactgattcatatagttacattcaatgaattcatct 46582736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University