View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11328_high_12 (Length: 308)

Name: NF11328_high_12
Description: NF11328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11328_high_12
NF11328_high_12
[»] chr6 (1 HSPs)
chr6 (82-180)||(33756982-33757080)
[»] chr4 (1 HSPs)
chr4 (4-88)||(963167-963251)


Alignment Details
Target: chr6 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 82 - 180
Target Start/End: Complemental strand, 33757080 - 33756982
Alignment:
Q  82 ggttgtgattgtttcacgcatatatggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataactaactttcacggc 180  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  33757080 ggttgtgattgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataacaaactttcacggc 33756982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 88
Target Start/End: Original strand, 963167 - 963251
Alignment:
Q  4 tggactaatcaaggtaatatttgttccaaacaggttgcagaatatggagaagaaggagaagttgttggagtgataaggggttgtg 88  Q
    |||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||    
T  963167 tggactaatcaatgtaatatttgttccaaacaggttgcagaatatgaagaagaaggagaagttgctggagtgataaggggttgtg 963251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University